A three-gene system of additive genes (A, B, and C) controls plant height. Each gene has two alleles (A and a, B and b, and C and c). There is dominance among the alleles of each gene, with alleles A, B, and C dominant over a, b, and c. Under this scheme, the dominant genotype for a gene contributes 10 cm to height potential, and the recessive genotype contributes 4 cm. What is the height potential of the F₁ progeny of the homozygous plants identified in (a) and (b) of this problem?

A three-gene system of additive genes (A, B, and C) controls plant height. Each gene has two alleles (A and a, B and b, and C and c). There is dominance among the alleles of each gene, with alleles A, B, and C dominant over a, b, and c. Under this scheme, the dominant genotype for a gene contributes 10 cm to height potential, and the recessive genotype contributes 4 cm. What are the phenotypes and proportions of each phenotype among the F₂?
Verified step by step guidance
Verified video answer for a similar problem:
Key Concepts
Additive Gene Interaction
Dominance and Alleles
Phenotypic Ratios in F₂ Generation
You have cloned a gene for an enzyme that degrades lipids in a bacterium that normally lives in cold temperatures. You wish to transfer this gene into E. coli to produce industrial amounts of enzyme for use in laundry detergent.
How would you accomplish this?
Vitamin E is the name for a set of chemically related tocopherols, which are lipid-soluble compounds with antioxidant properties. Such antioxidants protect cells against the effects of free radicals created as by-products of energy metabolism in the mitochondrion. Different tocopherols have different biological activities due to differences in their retention by binding to gut proteins during digestion. The one retained at the highest level is α-tocopherol, whereas γ-tocopherol is retained at less than 10% of that efficiency. In Arabidopsis, α-tocopherol is the most abundant tocopherol in leaves, whereas γ-tocopherol is the most abundant in seeds. An enzyme encoded by the VTE4 gene can convert γ-tocopherol to α-tocopherol. How would you create an Arabidopsis plant that produces high levels of α-tocopherol in the seeds?
The RAS gene encodes a signaling protein that hydrolyzes GTP to GDP. When bound by GDP, the RAS protein is inactive, whereas when bound by GTP, RAS protein activates a target protein, resulting in stimulation of cells to actively grow and divide. As shown in the accompanying sequence, a single base-pair mutation results in a mutant protein that is constitutively active, leading to continual promotion of cell proliferation. Such mutations play a role in the formation of cancer. You have cloned the wild-type version of the mouse RAS gene and wish to create a mutant form to study its biological activity in vitro and in transgenic mice. Outline how you would proceed.
The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.
ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA
GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC
You have cloned a gene for an enzyme that degrades lipids in a bacterium that normally lives in cold temperatures. You wish to transfer this gene into E. coli to produce industrial amounts of enzyme for use in laundry detergent.
You have managed to produce transgenic E. coli expressing mRNA of your gene, but only a low level of protein is produced. Why might this be so? How could you overcome this problem?
