Skip to main content
Ch. 15 - Recombinant DNA Technology and Its Applications
Sanders - Genetic Analysis: An Integrated Approach 3rd Edition
Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172Not the one you use?Change textbook
Chapter 15, Problem 29

Vitamin E is the name for a set of chemically related tocopherols, which are lipid-soluble compounds with antioxidant properties. Such antioxidants protect cells against the effects of free radicals created as by-products of energy metabolism in the mitochondrion. Different tocopherols have different biological activities due to differences in their retention by binding to gut proteins during digestion. The one retained at the highest level is α-tocopherol, whereas γ-tocopherol is retained at less than 10% of that efficiency. In Arabidopsis, α-tocopherol is the most abundant tocopherol in leaves, whereas γ-tocopherol is the most abundant in seeds. An enzyme encoded by the VTE4 gene can convert γ-tocopherol to α-tocopherol. How would you create an Arabidopsis plant that produces high levels of α-tocopherol in the seeds?

Verified step by step guidance
1
Identify the role of the VTE4 gene in tocopherol conversion: The VTE4 gene encodes an enzyme that converts γ-tocopherol to α-tocopherol. This is a key step in determining the levels of α-tocopherol in different tissues of Arabidopsis.
Determine the expression pattern of the VTE4 gene: In wild-type Arabidopsis, the VTE4 gene may not be highly expressed in seeds, which is why γ-tocopherol is more abundant in seeds compared to α-tocopherol.
Design a genetic modification strategy: To increase α-tocopherol levels in seeds, you could use a seed-specific promoter to drive the expression of the VTE4 gene. A seed-specific promoter ensures that the gene is expressed only in the seeds, where the conversion of γ-tocopherol to α-tocopherol is desired.
Introduce the modified VTE4 gene into Arabidopsis: Use a genetic transformation method, such as Agrobacterium-mediated transformation, to insert the VTE4 gene under the control of the seed-specific promoter into the Arabidopsis genome.
Verify and analyze the results: Grow the transformed plants and analyze the tocopherol content in the seeds using techniques like high-performance liquid chromatography (HPLC) to confirm that α-tocopherol levels have increased significantly compared to wild-type plants.

Verified video answer for a similar problem:

This video solution was recommended by our tutors as helpful for the problem above.
Video duration:
3m
Was this helpful?

Key Concepts

Here are the essential concepts you must grasp in order to answer the question correctly.

Tocopherols and Their Functions

Tocopherols are a group of fat-soluble compounds, primarily known for their role as antioxidants. They protect cells from oxidative damage caused by free radicals, which are by-products of cellular metabolism. The most studied tocopherol, α-tocopherol, is particularly effective in this role and is retained more efficiently in the body compared to other forms like γ-tocopherol.
Recommended video:
Guided course
08:26
Functional Genomics

Genetic Engineering in Plants

Genetic engineering involves modifying an organism's DNA to achieve desired traits, such as increased nutrient production. In the context of Arabidopsis, techniques like CRISPR or transgenic approaches can be used to enhance the expression of specific genes, such as the VTE4 gene, which converts γ-tocopherol to α-tocopherol, thereby increasing α-tocopherol levels in seeds.
Recommended video:
Guided course
02:56
Plant Gamete Terminology

Gene Expression Regulation

Gene expression regulation is the process by which cells control the amount and timing of protein production. In plants, this can involve various mechanisms, including promoter selection and transcription factor binding. Understanding how to manipulate these regulatory elements can help in designing Arabidopsis plants that produce higher levels of α-tocopherol by ensuring that the VTE4 gene is expressed more effectively in seeds.
Recommended video:
Guided course
02:09
Penetrance and Expressivity
Related Practice
Textbook Question

A three-gene system of additive genes (A, B, and C) controls plant height. Each gene has two alleles (A and a, B and b, and C and c). There is dominance among the alleles of each gene, with alleles A, B, and C dominant over a, b, and c. Under this scheme, the dominant genotype for a gene contributes 10 cm to height potential, and the recessive genotype contributes 4 cm. What is the height potential of the F₁ progeny of the homozygous plants identified in (a) and (b) of this problem?

5
views
Textbook Question

You have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.

How can you identify the gene adjacent to the insertion site of the enhancer trap?

Textbook Question

You have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.

How would you show that the expression pattern of the enhancer trap line reflects the endogenous gene expression pattern of the adjacent gene?

Textbook Question

The RAS gene encodes a signaling protein that hydrolyzes GTP to GDP. When bound by GDP, the RAS protein is inactive, whereas when bound by GTP, RAS protein activates a target protein, resulting in stimulation of cells to actively grow and divide. As shown in the accompanying sequence, a single base-pair mutation results in a mutant protein that is constitutively active, leading to continual promotion of cell proliferation. Such mutations play a role in the formation of cancer. You have cloned the wild-type version of the mouse RAS gene and wish to create a mutant form to study its biological activity in vitro and in transgenic mice. Outline how you would proceed.

Textbook Question

A three-gene system of additive genes (A, B, and C) controls plant height. Each gene has two alleles (A and a, B and b, and C and c). There is dominance among the alleles of each gene, with alleles A, B, and C dominant over a, b, and c. Under this scheme, the dominant genotype for a gene contributes 10 cm to height potential, and the recessive genotype contributes 4 cm. What are the phenotypes and proportions of each phenotype among the F₂?

Textbook Question

The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.

ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA

GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC