Skip to main content
Ch. 15 - Recombinant DNA Technology and Its Applications
Sanders - Genetic Analysis: An Integrated Approach 3rd Edition
Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172Not the one you use?Change textbook
Chapter 15, Problem 29c

A three-gene system of additive genes (A, B, and C) controls plant height. Each gene has two alleles (A and a, B and b, and C and c). There is dominance among the alleles of each gene, with alleles A, B, and C dominant over a, b, and c. Under this scheme, the dominant genotype for a gene contributes 10 cm to height potential, and the recessive genotype contributes 4 cm. What is the height potential of the F₁ progeny of the homozygous plants identified in (a) and (b) of this problem?

Verified step by step guidance
1
Step 1: Understand the genetic system described in the problem. Each gene (A, B, and C) has two alleles: a dominant allele (A, B, C) and a recessive allele (a, b, c). The dominant allele contributes 10 cm to plant height, while the recessive allele contributes 4 cm.
Step 2: Determine the genotypes of the homozygous parent plants mentioned in parts (a) and (b). Homozygous means both alleles for each gene are the same. For example, one parent could be homozygous dominant (AA, BB, CC), and the other could be homozygous recessive (aa, bb, cc).
Step 3: Predict the genotype of the F₁ progeny. When crossing a homozygous dominant parent (AA, BB, CC) with a homozygous recessive parent (aa, bb, cc), the F₁ progeny will inherit one dominant allele and one recessive allele for each gene, resulting in a heterozygous genotype (Aa, Bb, Cc).
Step 4: Calculate the height contribution of each gene in the F₁ progeny. Since the F₁ progeny are heterozygous (Aa, Bb, Cc), the dominant allele in each gene will determine the height contribution. For each gene, the dominant allele contributes 10 cm.
Step 5: Add the height contributions from all three genes to determine the total height potential of the F₁ progeny. Sum the contributions from the dominant alleles of genes A, B, and C to find the total height potential.

Verified video answer for a similar problem:

This video solution was recommended by our tutors as helpful for the problem above.
Video duration:
3m
Was this helpful?

Key Concepts

Here are the essential concepts you must grasp in order to answer the question correctly.

Additive Gene Action

Additive gene action refers to the cumulative effect of multiple genes on a single trait, where each gene contributes a specific amount to the phenotype. In this case, the three genes (A, B, and C) each add to the plant height, with dominant alleles contributing more than recessive ones. Understanding this concept is crucial for predicting the overall phenotype based on the genotypes of the parents.
Recommended video:
Guided course
09:09
Mapping Genes

Dominance and Alleles

Dominance describes the relationship between alleles, where a dominant allele masks the effect of a recessive allele in a heterozygous genotype. In this scenario, alleles A, B, and C are dominant over their respective recessive alleles a, b, and c. Recognizing which alleles are dominant helps in determining the potential contributions to the phenotype from each gene.
Recommended video:
Guided course
04:37
Variations on Dominance

Genotype to Phenotype Conversion

The conversion from genotype to phenotype involves translating the genetic makeup (genotype) into observable traits (phenotype). In this problem, the height potential is calculated based on the genotypes of the homozygous parent plants, where each dominant allele contributes 10 cm and each recessive allele contributes 4 cm. This understanding is essential for calculating the expected height of the F₁ progeny.
Recommended video:
Guided course
02:36
Gene Conversion
Related Practice
Textbook Question

You have cloned a gene for an enzyme that degrades lipids in a bacterium that normally lives in cold temperatures. You wish to transfer this gene into E. coli to produce industrial amounts of enzyme for use in laundry detergent.

How would you accomplish this?

4
views
Textbook Question

Vitamin E is the name for a set of chemically related tocopherols, which are lipid-soluble compounds with antioxidant properties. Such antioxidants protect cells against the effects of free radicals created as by-products of energy metabolism in the mitochondrion. Different tocopherols have different biological activities due to differences in their retention by binding to gut proteins during digestion. The one retained at the highest level is α-tocopherol, whereas γ-tocopherol is retained at less than 10% of that efficiency. In Arabidopsis, α-tocopherol is the most abundant tocopherol in leaves, whereas γ-tocopherol is the most abundant in seeds. An enzyme encoded by the VTE4 gene can convert γ-tocopherol to α-tocopherol. How would you create an Arabidopsis plant that produces high levels of α-tocopherol in the seeds?

Textbook Question

You have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.

How would you show that the expression pattern of the enhancer trap line reflects the endogenous gene expression pattern of the adjacent gene?

Textbook Question

The RAS gene encodes a signaling protein that hydrolyzes GTP to GDP. When bound by GDP, the RAS protein is inactive, whereas when bound by GTP, RAS protein activates a target protein, resulting in stimulation of cells to actively grow and divide. As shown in the accompanying sequence, a single base-pair mutation results in a mutant protein that is constitutively active, leading to continual promotion of cell proliferation. Such mutations play a role in the formation of cancer. You have cloned the wild-type version of the mouse RAS gene and wish to create a mutant form to study its biological activity in vitro and in transgenic mice. Outline how you would proceed.

Textbook Question

A three-gene system of additive genes (A, B, and C) controls plant height. Each gene has two alleles (A and a, B and b, and C and c). There is dominance among the alleles of each gene, with alleles A, B, and C dominant over a, b, and c. Under this scheme, the dominant genotype for a gene contributes 10 cm to height potential, and the recessive genotype contributes 4 cm. What are the phenotypes and proportions of each phenotype among the F₂?

Textbook Question

The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.

ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA

GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC