Multiple Choice
What is their proper sequence for these steps?
1. translation
2. RNA processing
3. transcription
4. modification of protein
1. translation
2. RNA processing
3. transcription
4. modification of protein
1
views
15. Gene Expression
Review of Transcription vs. Translation
Back15. Gene Expression
Review of Transcription vs. Translation
- Multiple ChoiceWhich of the following does not occur during translation?1views
- Multiple ChoiceWhat is a significant difference between translation in bacterial cells and eukaryotic cells?
- Multiple ChoiceWhich of the following is NOT a difference between DNA and RNA synthesis?1views
- Multiple ChoiceWhy is RNA synthesis called transcription and protein synthesis called translation?
- Multiple ChoiceWhich of the following is true of transcription but not translation?
- Multiple ChoiceWhich of the following is a similarity between transcription and translation?1views
- Multiple ChoiceWhich statement best describes the relationship between transcription and translation?
- Multiple ChoiceWhich process is depicted in the image below, where RNA is synthesized from a DNA template?1views
- Multiple ChoiceAt one point, as a cell carried out its day-to-day activities, the nucleotides GAT were paired with the nucleotides CUA. This pairing occurred __________.1views
- Multiple ChoiceWhich summary of protein synthesis is correct?1views
- Multiple ChoiceWhat is the relationship between transcription and translation in the process of gene expression?
- Multiple ChoiceWhich of the following correctly distinguishes transcription from translation in eukaryotic cells?1views
- Multiple Choice
Which of the following polypeptide chains are synthesized from the RNA sequence:
5' – AUGAUCCGAAGUGGCACAGCAUAA - 3'
2views - Multiple ChoiceWhich of the following is true of both transcription and translation?1views