15. Gene Expression
Review of Transcription vs. Translation
Learn with other creators
Practice this topic
- Multiple Choice
What is the central dogma of molecular biology directly referring to?
2views - Open Question
Consider a DNA template strand of the following sequence: 5'-A C T G C C A G G A A T-3'.
A) What is the sequence of the corresponding DNA coding strand? Include directionality.
DNA Template Strand: 5'-A C T G C C A G G A A T-3'.
DNA Coding Strand:
B) What is the sequence of the corresponding mRNA strand? Include directionality.mRNA Strand:
2views - Open Question
Consider a DNA coding strand with the following sequence: 3'-C T T C A T A G C T C G-5'.
Use the genetic code to determine the corresponding amino acid sequence of the translated protein.
DNA Coding Strand: 3'- C T T C A T A G C T C G -5'
mRNA Strand:
Protein Sequence:2views - Multiple Choice
Which of the following polypeptide chains are synthesized from the RNA sequence:
5' – AUGAUCCGAAGUGGCACAGCAUAA - 3'
2views - Multiple ChoiceAt one point, as a cell carried out its day-to-day activities, the nucleotides GAT were paired with the nucleotides CUA. This pairing occurred __________.1views
- Multiple ChoiceWhich summary of protein synthesis is correct?1views



